ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
C___2104738_10SI000341ILactaseLCT
FstAvg Het# Populations Typed
0.1170.39785
Synonyms: rs3754689 ; G666A ;
Frequency on Map:    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: GenBank sequence Record  dbSNP rs# Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  C___2104738_10 is an ABI Assays-on-DemandTM SNP Genotyping Assay ID. This is T/C SNP (reverse) which results in nonsynonymous substitution Isoleucine -> Valine in the coding region (aminoacid position 219) of LCT gene.
Alleles:
Allele NameAllele SymbolDescription
AA5' - tttcaggcggaaaactctct ATT gtcctgcgagctgaagat - 3'
GG5' - tttcaggcggaaaactctct GTT gtcctgcgagctgaagat - 3'

References:
- Harvey CB, Hollox EJ, Poulter M, Wang Y, Rossi M, Auricchio S, Iqbal TH, Cooper BT, Barton R, Sarner M, Korpela R, Swallow DM. "Lactase haplotype frequencies in Caucasians: association with the lactase persistence/non-persistence polymorphism". Ann Hum Genet 62:215-23. (1998) Online citation.

- Hollox EJ, Poulter M, Zvarik M, Ferak V, Krause A, Jenkins T, Saha N, Kozlov AI, Swallow DM. "Lactase Haplotype Diversity in the Old World ". Am. J. Hum. Genet. 68:160-172. (2001) Online citation.

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan