ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
Ile114ThrSI000408MN-acetyltransferase 2 (arylamine N-acetyltransferase)NAT2
FstAvg Het# Populations Typed
0.1250.34411
Synonyms: SNP45-NAT2 ; rs1801280 ;
Frequency on Map:    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: dbSNP rs# Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  This is a A/G SNP in the coding region of NAT2 gene. This SNP results in nonsynonymous change Isoleucine(ATT) -> Threonine(ACT) at aminoacid position 114 of the gene.
Alleles:
Allele NameAllele SymbolDescription
CC5' - ttctcctgcaggtgacc ACT gacggcaggaattacattgt - 3'
TT5' - ttctcctgcaggtgacc ATT gacggcaggaattacattgt - 3'

References:
- Goddard KA, Hopkins PJ, Hall JM, Witte JS. "Linkage Disequilibrium and Allele-Frequency Distributions for 114 Single-Nucleotide Polymorphisms in Five Populations ". Am. J. Hum. Genet. 66:216-234. (2000) Online citation.

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan