ALFRED

The ALlele FREquency Database
A resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.

ALFRED detailed record information

Polymorphism Information

Name	ALFRED UID	Locus Name	Locus Symbol
E_rs1587264_10	SI001677V	rs1587264 is intergenic between ADH1A and ADH1B	rs1587264

Previously associated with : ADH1B

Fst	Avg Het	# Populations Typed
0.093	0.342	40

Synonyms: rs1587264 ;
Frequency Display Formats:

Estimated Heterozygosity:

Frequency Download:

External Resources: dbSNP rs # Record PharmGKB Variant Information Record
References: See References
Polymorphism Description: E_rs1587264_10 is an ABI Assays-on-Demand^TM SNP Genotyping Assay ID. This is a A/G SNP in the intergenic region of ADH1B-1A genes.

Note:This taqman assay types the other strand and the corresponding alleles are T and C respectively.
Ancestral Allele: A
Alleles:
Allele Name Allele Symbol Description
A A 5' - attagaaatgaaatgggaa A aattacaaccaataccacaa - 3'
G G 5' - attagaaatgaaatgggaa G aattacaaccaataccacaa - 3'

References:
- Han Y, Oota H, Sheng Gu, Osier M, Pakstis AJ, Speed WC, Kidd JR, Kidd KK "Evidence of Positive Selection on a Class I ADH Locus". American Journal of Human Genetics 80:441-56. (2007) Online citation.

© 2009 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan