ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
intron 13 C/T (-13910 ) SNPSI001784UMCM6 minichromosome maintenance deficient 6MCM6
FstAvg Het# Populations Typed
0.3570.19688
Synonyms: rs4988235 ;
Frequency on Map:    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: dbSNP rs # Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  This is a C/T SNP in the intron region of MCM6 gene. The -13910*T allele introduces a BsmFI restriction site.The primer sets ,pcr amplification conditions and restriction product sizes are detailed in Coelho et.al.

Studies have shown that this nucleotide change affects lactase promoter activity and thus is highly likely to cause lactase persistence. This polymorphism is associated with lactase persistence seen in European populations.
Alleles:
Allele NameAllele SymbolDescription
CC5' - atacagataagataatgtag C ccctggcctcaaaggaactc - 3'
TT5' - atacagataagataatgtag T ccctggcctcaaaggaactc - 3'

References:
- Coelho M, Luiselli D, Bertorelle G, Lopes AI, Seixas S, Destro-Bisol G, Rocha J. "Microsatellite variation and evolution of human lactase persistence". Hum Genet. 117:329-339. (2005) Online citation.

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan