ALFRED: allele frequency database

The ALlele FREquency Database
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.

ALFRED detailed record information

Polymorphism Information

Name	ALFRED UID	Locus Name	Locus Symbol
C___1605849_10	SI003939Y	olfactory receptor, family 52, subfamily E, member 1 (gene/pseudogene)	OR52E1

Fst	Avg Het	# Populations Typed
0.07	0.401	55

Synonyms: rs1455962 ;
Frequency Display Formats:

Estimated Heterozygosity:

Frequency Download:

External Resources: dbSNP rs # Record PharmGKB Variant Information Record
References: See References
Polymorphism Description: C___1605849_10 is an ABI Assays-on-Demand^TM SNP Genotyping Assay ID. This is a A/G SNP.
Ancestral Allele: A
Alleles:

Allele Name	Allele Symbol	Description
A	A	5' - acggtacaaaacccaccctc A taagcaaatggaattcagaa - 3'
G	G	5' - acggtacaaaacccaccctc G taagcaaatggaattcagaa - 3'

References:
- Kenneth K. Kidd et al. "Data unpublished".

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan