ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
C_____10567_20SI003987Bcyclin-Y-like protein 2-likeLOC100653020
FstAvg Het# Populations Typed
0.0810.37369
Synonyms: rs719366 ;
Frequency on Map:    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: dbSNP rs # Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  C_____10567_20 is an ABI Assays-on-DemandTM SNP Genotyping Assay ID. This is a C/T SNP in the intron region of LOC388526 gene.

Note:Sanchez JJ etal.(2006) originally typed this marker on 9 population samples as part of the SNPforID panel for individual identification. Others have subsequently typed this SNP on additional populations.


Ancestral Allele:  T
Alleles:
Allele NameAllele SymbolDescription
CC5' - ttttcctcctcccattctag C agctactcctctgggggcct - 3'
TT5' - ttttcctcctcccattctag T agctactcctctgggggcct - 3'

References:
- Kenneth K. Kidd et al. "Data unpublished".

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan