ALFRED: allele frequency database

The ALlele FREquency Database
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.

ALFRED detailed record information

Polymorphism Information

Name	ALFRED UID	Locus Name	Locus Symbol
rs2016276	SI004009N	rs2016276 is intergenic between PWRN2 and PWRN1	rs2016276

Fst	Avg Het	# Populations Typed
0.069	0.365	29

Synonyms: rs2016276 ;
Frequency Display Formats:

Estimated Heterozygosity:

Frequency Download:

External Resources: dbSNP rs # Record PharmGKB Variant Information Record
References: See References
Polymorphism Description: This is a A/G SNP.
Alleles:

Allele Name	Allele Symbol	Description
A	A	5' - gacagtccacacattcagct A gcacatttttctctctctca - 3'
G	G	5' - gacagtccacacattcagct G gcacatttttctctctctca - 3'

References:
- Sánchez JJ, Phillips C, Borsting C, Balogh K, Bogus M, Fondevila M, Harrison CD, Musgrave-Brown E, Salas A, Syndercombe-Court D, Schneider PM, Carracedo A, Morling N. "A multiplex assay with 52 single nucleotide polymorphisms for human identification". Electrophoresis. 27:1713-1724. (2006) Online citation.

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan