ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
rs2040411SI004024Krs2040411 is intergenic between LOC339685 and FLJ46257rs2040411
FstAvg Het# Populations Typed
0.190.399125
Synonyms: rs2040411 ; C_11482429_10 ;
Frequency on Map:    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: dbSNP rs # Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  This is a A/G SNP.

Note:Note: This marker is part of two SNPforID forensic panels, the 52-plex set for individual identification (Sanchez JJ etal.,2006) and the 34-plex set for inferring ancestry information (Phillips C etal.,2007).
Sanchez JJ etal.(2006) originally typed this marker on 9 population samples as part of the SNPforID panel for individual identification. Others have subsequently typed this SNP on additional populations.


Ancestral Allele:  A
Alleles:
Allele NameAllele SymbolDescription
AA5' - tattttcttactctaagtgc A tatttcatgagaactggttt - 3'
GG5' - tattttcttactctaagtgc G tatttcatgagaactggttt - 3'

References:
- Sánchez JJ, Phillips C, Borsting C, Balogh K, Bogus M, Fondevila M, Harrison CD, Musgrave-Brown E, Salas A, Syndercombe-Court D, Schneider PM, Carracedo A, Morling N. "A multiplex assay with 52 single nucleotide polymorphisms for human identification". Electrophoresis. 27:1713-1724. (2006)
Online citation.


© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan