ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
Thr100ThrSI004306NTaste receptor, type 2, member 16TAS2R16
FstAvg Het# Populations Typed
0.1550.03756
Synonyms: rs2233988 ;
Frequency on Map:    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: dbSNP rs# Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  This is a C/T SNP in the coding region of TAS2R16 gene. This SNP results in synonymous substitution Threonine(ACC) -> Threonine(ACT) at aminoacid position 100 of the gene.
Ancestral Allele:  C
Alleles:
Allele NameAllele SymbolDescription
ThrC5' - tggttaaacagcttgctt ACC gtgttctactgcatcaaggt - 3'
ThrT5' - tggttaaacagcttgctt ACT gtgttctactgcatcaaggt - 3'

References:
- Soranzo N, Bufe B, Sabeti PC, Wilson JF, Weale ME, Marguerie R, Meyerhof W, Goldstein DB. "Positive selection on a high-sensitivity allele of the human bitter-taste receptor TAS2R16". Curr Biol. 15:1257-1265. (2005) Online citation.

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan