ALFRED: allele frequency database

The ALlele FREquency Database
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.

ALFRED detailed record information

Polymorphism Information

Name	ALFRED UID	Locus Name	Locus Symbol
Val101Val	SI006521O	Taste receptor, type 2, member 16	TAS2R16

Fst	Avg Het	# Populations Typed
0.839	0.081	91

Synonyms:
Frequency Display Formats:

Estimated Heterozygosity:

Frequency Download:

External Resources: dbSNP rs# Record PharmGKB Variant Information Record
References: See References
Polymorphism Description: This is a C/G SNP in the coding region of TAS2R16 gene. This transversion substitution results in synonymous change Valine(GTC) -> Valine(GTG) at aminoacid position 101 of the gene.
Ancestral Allele: G
Alleles:

Allele Name	Allele Symbol	Description
Val	C	5' - tctggttaaacagcttgcttacc GTC ttctactgcatcaaggtcttctt - 3'
Val	G	5' - tctggttaaacagcttgcttacc GTG ttctactgcatcaaggtcttctt - 3'

References:
- Soranzo N, Bufe B, Sabeti PC, Wilson JF, Weale ME, Marguerie R, Meyerhof W, Goldstein DB. "Positive selection on a high-sensitivity allele of the human bitter-taste receptor TAS2R16". Curr Biol. 15:1257-1265. (2005) Online citation.

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan