ALFRED: allele frequency database

The ALlele FREquency Database
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.

ALFRED detailed record information

Polymorphism Information

Name	ALFRED UID	Locus Name	Locus Symbol
rs2026721	SI007621Q	rs2026721 is intergenic between TMEM144 and LOC646890	rs2026721

Fst	Avg Het	# Populations Typed
0.301	0.158	106

Synonyms: rs2026721 ; C___2722372_10 ;
Frequency Display Formats:

Estimated Heterozygosity:

Frequency Download:

External Resources: dbSNP rs# Record PharmGKB Variant Information Record
References: See References
Polymorphism Description: This is a A/G SNP.
Ancestral Allele: G
Alleles:

Allele Name	Allele Symbol	Description
A	A	5' - tgacatagtaggctattg A gaaaacatttctgcctcgtg - 3'
G	G	5' - tgacatagtaggctattg G gaaaacatttctgcctcgtg - 3'

References:
- Phillips C, Salas A, Sánchez JJ, Fondevila M, Gómez-Tato A, Álvarez-Dios J, Calaza M, Casares de Cal M , Ballard D, Lareu MV, Carracedo A - The SNPforID Consortium "Inferring ancestral origin using a single multiplex assay of ancestry-informative marker SNPs". Forensic Science International: Genetics 1:273-280. (2007) Online citation.

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan