ALFRED: allele frequency database

The ALlele FREquency Database
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.

ALFRED detailed record information

Polymorphism Information

Name	ALFRED UID	Locus Name	Locus Symbol
rs2814778	SI007627W	Duffy blood group	DARC

Fst	Avg Het	# Populations Typed
0.75	0.07	117

Synonyms: rs2814778 ;
Frequency Display Formats:

Estimated Heterozygosity:

Frequency Download:

External Resources: dbSNP rs# Record PharmGKB Variant Information Record
References: See References
Polymorphism Description: This is a T/C SNP (+ /coding strand) in the 5'UTR of DARC gene. This SNP disrupts a GATA-1 binding site and prevents transcription in erythroid cells resulting in the Duffy null phenotype when homozygous. Because the derived Duffy null allele has a high frequency in most sub-saharan African populations and rare occurence elsewhere, this SNP is often included in global ancestry informative SNP panels and in panels of SNPs used to estimate admixture in African Americans.
Ancestral Allele: A on the minus strand
Alleles:

Allele Name	Allele Symbol	Description
C	C	5'-ggccctcattagtccttggctctta C cttggaagcacaggcgctgacagccg -3'
T	T	5'-ggccctcattagtccttggctctta T cttggaagcacaggcgctgacagccg -3'

References:
- Phillips C, Salas A, Sánchez JJ, Fondevila M, Gómez-Tato A, Álvarez-Dios J, Calaza M, Casares de Cal M , Ballard D, Lareu MV, Carracedo A - The SNPforID Consortium "Inferring ancestral origin using a single multiplex assay of ancestry-informative marker SNPs". Forensic Science International: Genetics 1:273-280. (2007) Online citation.

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan