ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
rs881929SI008731TZinc finger protein 668ZNF668
FstAvg Het# Populations Typed
0.2910.354113
Synonyms: rs881929 ; rs881929 ; C___7473941_10 ;
Frequency on Map:    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: dbSNP rs# Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  This is a G/T SNP in the intron region of ZNF668 gene.
Ancestral Allele:  G
Alleles:
Allele NameAllele SymbolDescription
GG5' ¿ actgcctcttgccagctctg G gtctcagccttcctatctgt - 3'
TT5' ¿ actgcctcttgccagctctg T gtctcagccttcctatctgt - 3'

References:
- Phillips C, Salas A, Sánchez JJ, Fondevila M, Gómez-Tato A, Álvarez-Dios J, Calaza M, Casares de Cal M , Ballard D, Lareu MV, Carracedo A - The SNPforID Consortium "Inferring ancestral origin using a single multiplex assay of ancestry-informative marker SNPs". Forensic Science International: Genetics 1:273-280. (2007)
Online citation.


© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan