ALFRED: allele frequency database

The ALlele FREquency Database
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.

ALFRED detailed record information

Polymorphism Information

Name	ALFRED UID	Locus Name	Locus Symbol
G801A	SI013962V	Chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1)	CXCL12

Fst	Avg Het	# Populations Typed
0.143	0.305	146

Synonyms: SDF1-3'A ; rs1801157 ;
Frequency Display Formats:

Estimated Heterozygosity:

Frequency Download:

External Resources: pubmed citation Record PharmGKB Variant Information Record
References: See References
Polymorphism Description: This is a G/A SNP in the 3'UTR of the SDF1 gene transcript. This mutation is commonly abbreviated as SDF1-3'A and is represented only in the SDF-1beta transcript but not in the SDF-1Alpha transcript. This G -> A transtition is at position 801 (counting from the ATG start codon) in the 3'UTR of the reference sequence (GenBank accession number L36033).
Ancestral Allele: G
Alleles:

Allele Name	Allele Symbol	Description
A	A	5' - tctccatccacatgggagcc A ggtctgcctcttctgggagg - 3'
G	G	5' - tctccatccacatgggagcc G ggtctgcctcttctgggagg - 3'

References:
- Ma L, Marmor M, Zhong P, Ewane L, Su B, Nyambi P. "Distribution of CCR2-64I and SDF1-3'A alleles and HIV status in 7 ethnic populations of Cameroon". J Acquir Immune Defic Syndr. 40:89-95. (2005) Online citation.

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan