ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
Thr60SerSI015427TAlcohol Dehydrogenase 1B (class I), beta polypeptide ADH1B
FstAvg Het# Populations Typed
0.0040.01317
Synonyms: rs6413413 ;
Frequency on Map:    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: dbSNP rs# Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  This is a A/T SNP in the coding region of ADH1B gene. This SNP results in non-synonymous substitution Threonine (ACC) -> Serine (TCC) at aminoacid position 60 of the gene.
Alleles:
Allele NameAllele SymbolDescription
SerT5'- gtggttagtggcaacctggtg TCC ccccttcctgtgatttta -3'
ThrA5'- gtggttagtggcaacctggtg ACC ccccttcctgtgatttta -3'

References:
- Hashibe M, McKay JD, Curado MP, Oliveira JC, Koifman S, Koifman R, Zaridze D, Shangina O, Wünsch-Filho V, Eluf-Neto J, Levi JE, Matos E, Lagiou P, Lagiou A, Benhamou S et.al. "Multiple ADH genes are associated with upper aerodigestive cancers". Nat Genet. 40:707-9. (2008) Online citation.

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan