ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
rs2279744SI018438YMdm2 p53 binding protein homolog (mouse)MDM2
FstAvg Het# Populations Typed
0.0970.42845
Synonyms:
Frequency on Map:    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: dbSNP rs# Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  This is a G/T SNP in the intron region of MDM2 gene.
Ancestral Allele:  T
Alleles:
Allele NameAllele SymbolDescription
GG5'- ccgggggctgcggggccgct G cggcgcgggaggtccggatg -3'
TT5'- ccgggggctgcggggccgct T cggcgcgggaggtccggatg -3'

References:
- Shi H, Tan SJ, Zhong H, Hu W, Levine A, Xiao CJ, Peng Y, Qi XB, Shou WH, Ma RL, Li Y, Su B, Lu X "Winter temperature and UV are tightly linked to genetic changes in the p53 tumor suppressor pathway in Eastern Asia". Am J Hum Genet. 84:534-41.. (2009)
Online citation.


© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan