ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
rs35677470SI018502Qdeoxyribonuclease I-like 3DNASE1L3
FstAvg Het# Populations Typed
0.0460.039
Synonyms: rs35677470 ;
Frequency on Map:    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: dbSNP rs# Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  This is a A/G SNP in the coding region of DNASE1L3 gene. This SNP results in non-synonymous substitution Arginine(CGC) -> Cysteine(TGC) at aminoacid position 206 of the gene.
Alleles:
Allele NameAllele SymbolDescription
A (Cys)A5' - cctggggtcagtcctcaagc A gatgttcttccaggccttct-3'
G (Arg)G5'- cctggggtcagtcctcaagc G gatgttcttccaggccttct -3'

References:
- Ueki M, Takeshita H, Fujihara J, Iida R, Yuasa I, Kato H, Panduro A, Nakajima T, Kominato Y, Yasuda T. "Caucasian-specific allele in non-synonymous single nucleotide polymorphisms of the gene encoding deoxyribonuclease I-like 3, potentially relevant to autoimmunity, produces an inactive enzyme". Clin Chim Acta. 407:20-4. (2009) Online citation.

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan