ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
rs1045642 SI018624VATP-binding cassette, sub-family B (MDR/TAP), member 1ABCB1
FstAvg Het# Populations Typed
0.0060.2075
Synonyms: rs1045642 ; I1145I ; 3435C>T ;
Frequency on Map:    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: dbSNP rs# Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  This is a C/T SNP in the coding region of ABCB1 gene. This SNP results in synonymous substitution Isoleucine (ATT) -> Isoleucine (ATC) at aminoacid position 1145 of the gene.
Alleles:
Allele NameAllele SymbolDescription
C (Ile)C5'- gtggtgtcacaggaagag ATC gtgagggcagcaaaggaggc-3'
T (Ile)T5'-gtggtgtcacaggaagag ATT gtgagggcagcaaaggaggc -3'

References:
- Yen-Revollo JL, Van Booven DJ, Peters EJ, Hoskins JM, Engen RM, Kannall HD, Ofori-Adjei D, McLeod HL, Marsh S. "Influence of ethnicity on pharmacogenetic variation in the Ghanaian population". Pharmacogenomics J. (Epub ahead of print) (2009)
Online citation.


© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan