ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
rs1443985SI663700Wrs1443985 is intergenic between LOC348958 and PRR16rs1443985
Synonyms:
Frequency on Map:    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: dbSNP rs# Record  
References: See References
Polymorphism Description:  This is a A/G SNP.
Alleles:
Allele NameAllele SymbolDescription
AA5'- ctatacaaatgccctattaa A tacctaatttaaatgtgttt -3'
GG5'- ctatacaaatgccctattaa G tacctaatttaaatgtgttt -3'

References:
- Silva MC, Zuccherato LW, Soares-Souza GB, Vieira ZM, Cabrera L, Herrera P, Balqui J, Romero C, Jahuira H, Gilman RH, Martins ML, Tarazona-Santos E. "Development of two multiplex mini-sequencing panels of ancestry informative SNPs for studies in Latin Americans: an application to populations of the State of Minas Gerais (Brazil)". Genet Mol Res. 9:2069-85. (2010)
Online citation.


© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan