ALFRED: allele frequency database

The ALlele FREquency Database
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.

ALFRED detailed record information

Polymorphism Information

Name	ALFRED UID	Locus Name	Locus Symbol
Intron 4 VNTR	SI663748I	Nitric oxide synthase 3(endothelial cell)	NOS3

Fst	Avg Het	# Populations Typed
0.027	0.007	28

Synonyms:
Frequency Display Formats:

Estimated Heterozygosity:

Frequency Download:

External Resources:
References: See References
Polymorphism Description: This is a 27bp tandem repeats in the intron 4 region of eNOS3 gene. The Consensus sequence of 27bp is "GAAGTCTAGACCTGCTGCGGGGGTGAG'. The bigger allele 4B has five 27bp repeats and the smaller allele 4A has four repeats.
Alleles:

Allele Name	Allele Symbol	Description
4A	4A	4 tandem 27bp repeats
4B	4B	5 tandem 27bp repeats
4C	4C	6 tandem 27bp repeats
4y	4y	2 tandem 27bp repeats

References:
- Moe KT, Lim ST, Wong P, Chua T, DeSilva DA, Koh TH, Wong MC, Chin-Dusting J. "Association analysis of endothelial nitric oxide synthase gene polymorphism with primary hypertension in a Singapore population". J Hum Hypertens. 20:956-63. (2006) Online citation.

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan