ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
rs11074314SI663834EOculocutaneous albinism II (pink-eye dilution homolog, mouse)OCA2
FstAvg Het# Populations Typed
0.1980.21720
Synonyms: rs11074314 ;
Frequency on Map:    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: dbSNP rs# Record  
References: See References
Polymorphism Description:  This is a A/G SNP in the intron region of OCA2 gene.
Alleles:
Allele NameAllele SymbolDescription
AA5'- tcagagtagataaaaaatca Agatgctaatatatgctgctt -3'
GG5'- tcagagtagataaaaaatca Ggatgctaatatatgctgctt -3'

References:
- Michael P. Donnelly,Peristera Paschou,Elena Grigorenko,David Gurwitz,Csaba Barta,Ru-Band Lu,Olga V.Zhukova,Jong-Jin Kim,Marcello Siniscalco,Maria New ,Hui Li,Sylvester Kajuna,Vangelis G. Manolopoulos, William C. Speed, Andrew J. Pakstis,Judith R. Kidd, Kenneth K. Kidd "A global view of the OCA2-HERC2 region and pigmentation". Human Genet 131:683-696. (2012)
Online citation.


© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan