ALFRED: allele frequency database

The ALlele FREquency Database
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.

ALFRED detailed record information

Polymorphism Information

Name	ALFRED UID	Locus Name	Locus Symbol
rs680	SI663847I	insulin-like growth factor 2 (somatomedin A)	IGF2

Fst	Avg Het	# Populations Typed
0	0.351	1

Synonyms: rs680 ;
Frequency Display Formats:

Estimated Heterozygosity:

Frequency Download:

External Resources: dbSNP rs# Record
References: See References
Polymorphism Description: This is a A/G SNP in the 3' UTR of Insulin gene.
Alleles:

Allele Name	Allele Symbol	Description
A	A	5'-ccagcaaagagaaaagaagg A ccccagaaatcacaggtggg -3'
G	G	5'- ccagcaaagagaaaagaagg G ccccagaaatcacaggtggg -3'

References:
- Cimponeriu D, Apostol P, Radu I, Craciun AM, Serafinceanu C, Toma M, Panaite C, Cheta D. "The insulin polymorphism -23Hph increases the risk for type 1 diabetes mellitus in the Romanian population". Genet Mol Biol 33:610-4. (2010) Online citation.

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan