ALFRED: allele frequency database

The ALlele FREquency Database
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.

ALFRED detailed record information

Polymorphism Information

Name	ALFRED UID	Locus Name	Locus Symbol
rs1288418	SI663953G	solute carrier family 1 (glutamate transporter), member 7	SLC1A7

Fst	Avg Het	# Populations Typed
0.257	0.229	56

Synonyms: rs1288418 ;
Frequency Display Formats:

Estimated Heterozygosity:

Frequency Download:

External Resources: dbSNP rs# Record
References: See References
Polymorphism Description: This is a C/T SNP in the intron region of SLC1A7 gene.
Alleles:

Allele Name	Allele Symbol	Description
C	C	5'- acaccaccgtagtacactca C tccacctcattacactcaca -3'
T	T	5'- acaccaccgtagtacactca T tccacctcattacactcaca -3'

References:
- Kenneth K. Kidd et al. "Data unpublished".

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan