ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
rs4545SI663989Pcytochrome P450, family 11, subfamily B, polypeptide 2CYP11B2
FstAvg Het# Populations Typed
0.250.14318
Synonyms: rs4545 ;
Frequency on Map:    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: dbSNP rs# Record  
References: See References
Polymorphism Description:  This is a A/G SNP in the coding region of CYP11B2 gene. This SNP results in non-synonymous substitution Glycine(GGC)-> Serine(AGC) at aminoacid position 435 of the gene.
Alleles:
Allele NameAllele SymbolDescription
A(Ser)A5'-ggctagacatcaggggctcc A gc aggaacttccaccacgtg -3'
G(Gly)G5'- ggctagacatcaggggctcc G gc aggaacttccaccacgtg -3'

References:
- Bulbul O, Filoglu G, Altuncul H, Aradas AF, Ruiz Y, Fondevila M, Phillips C, Carracedo A, Kriegel AK, Schneider PM "A SNP multiplex for the simulataneous prediction of biogeographic ancestry and pigmentaion type". Forensic science International:Genetics Supplement Series 3 e500-501. (2011)

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan