ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
rs17174476SI663991IMatrix metallopeptidase 20 (enamelysin)MMP20
FstAvg Het# Populations Typed
0.0120.48513
Synonyms: rs17174476 ;
Frequency on Map:    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: dbSNP rs# Record  
References: See References
Polymorphism Description:  This is an INDEL polymorphism in the intron region of MMP20 gene. THis polymorphism is part of the Investigator DIPplex kit.
Alleles:
Allele NameAllele SymbolDescription
Ins+5'-atatagtcatttgtcggttt GTTT gtgtttttcctttgagtgca -3'
del-5'-atatagtcatttgtcggttt gtgtttttcctttgagtgca -3'

References:
- Fondevila M, Pereira R, Gusmao L, Phillips C, Lareu MV, Carracedo A, Butler JM, Vallone PM "Forensic performance of two insertion-deletion marker assays ". Int J Legal Med. 126:725-37. (2012)
Online citation.

- Qiagen Investigator DIPplex® kit "Multiplex amplication of 30 deletion/insertion polymorphisms and amelogenin". (2011)


© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan