ALFRED

The ALlele FREquency Database
A resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.

ALFRED detailed record information

Polymorphism Information

Name	ALFRED UID	Locus Name	Locus Symbol
intron 9 G/A ( -22018 ) SNP	SI001785V	MCM6 minichromosome maintenance deficient 6	MCM6

Fst	Avg Het	# Populations Typed
0.293	0.126	53

Synonyms: rs182549 ;
Frequency Display Formats:

Estimated Heterozygosity:

Frequency Download:

External Resources: dbSNP rs # Record
References: See References
Polymorphism Description: This SNP is in the intron region of MCM6 gene. The -22018*G allele introduces Hin6I restriction site.

The primer sets ,pcr amplification conditions and restriction product sizes are detailed in Coelho et.al.
Alleles:
Allele Name Allele Symbol Description
C C 5' - gacaaaggtgtgagccaccg C gcccagctgagaatgctgtt - 3'
T T 5' - gacaaaggtgtgagccaccg T gcccagctgagaatgctgtt - 3'

References:
- Coelho M, Luiselli D, Bertorelle G, Lopes AI, Seixas S, Destro-Bisol G, Rocha J. "Microsatellite variation and evolution of human lactase persistence". Hum Genet. 117:329-339. (2005) Online citation.

© 2009 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan