ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
C_2688471SI001212GAlcohol Dehydrogenase 1B (class I), beta polypeptide ADH1B
FstAvg Het# Populations Typed
0.2340.38392
Synonyms: rs1159918 ;
Frequency on Map:    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: dbSNP rs # Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  C_2688471 is an ABI Assays-on-DemandTM SNP Genotyping Assay ID. This is a G/T SNP located in 5'upstream region of ADH1B gene.
Alleles:
Allele NameAllele SymbolDescription
GG5' - ctttgctgtgactaattggg G gtctgattctctgctgtaaa - 3'
TT5' - ctttgctgtgactaattggg T gtctgattctctgctgtaaa - 3'

References:
- Han Y, Oota H, Osier MV, Pakstis AJ, Speed WC, Odunsi A, Okonofua F, Kajuna SL, Karoma NJ, Kungulilo S, Grigorenko E, Zhukova OV, Bonne-Tamir B, Lu RB, Parnas J, Schulz LO, Kidd JR, Kidd KK. "Considerable Haplotype Diversity within the 23kb Encompassing the ADH7 Gene". Alcohol Clin Exp Res 29:2091-2100. (2005)
Online citation.


© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan