ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
FstAvg Het# Populations Typed
Synonyms: rs6719488 ;
Frequency on Map:    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: dbSNP rs # Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  C__25601938_10 is an ABI Assays-on-DemandTM SNP Genotyping Assay ID.This is G/T SNP which results in synonymous change Gly->Gly.
Allele NameAllele SymbolDescription
GG5' - caatcagcttgttgtagtaggcaac G cctgggaggctggggctgct - 3'
TT5' - caatcagcttgttgtagtaggcaac T cctgggaggctggggctgct - 3'

© 2014 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan