ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
C___2688547_10SI001465Qrs980972 is intergenic between ADH1C and ADH7rs980972
Previously associated with :  ADH1C
FstAvg Het# Populations Typed
0.1390.29762
Synonyms: rs980972 ;
Frequency on Map:    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: dbSNP rs # Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  C___2688547_10 is an ABI Assays-on-DemandTM SNP Genotyping Assay ID. This A/C SNP is located in ADH1C gene region.
Ancestral Allele:  A
Alleles:
Allele NameAllele SymbolDescription
AA5' - agtggggctggaaagagtttgagta A gactttcggctatctaccctgaatg - 3'
CC5' - agtggggctggaaagagtttgagta C gactttcggctatctaccctgaatg - 3'

References:

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan