ALFRED: allele frequency database

The ALlele FREquency Database
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.

ALFRED detailed record information

Polymorphism Information

Name	ALFRED UID	Locus Name	Locus Symbol
rs640198	SI001554P	Matrix metallopeptidase 13 (collagenase 3)	MMP13

Fst	Avg Het	# Populations Typed
0.058	0.47	4

Synonyms: rs640198 ;
Frequency Display Formats:

Estimated Heterozygosity:

Frequency Download:

External Resources: dbSNP rs# Record PharmGKB Variant Information Record
References: See References
Polymorphism Description: This is a A/C SNP in the intron region of MMP13 gene.
Ancestral Allele: G
Alleles:

Allele Name	Allele Symbol	Description
A	A	5' - tcattcattactttttaaag A attcaacactaatttaccaa - 3'
C	C	5' - tcattcattactttttaaag C attcaacactaatttaccaa - 3'

References:
- Beaty TH, Fallin MD, Hetmanski JB, McIntosh I, Chong SS, Ingersoll R, Sheng X, Chakraborty R, Scott AF. "Haplotype diversity in 11 candidate genes across four populations". Genetics 171:259-67. (2005) Online citation.

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan