ALFRED: allele frequency database

The ALlele FREquency Database
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.

ALFRED detailed record information

Polymorphism Information

Name	ALFRED UID	Locus Name	Locus Symbol
C___2538746_1_	SI001575S	Catechol-O-methyltransferase	COMT

Fst	Avg Het	# Populations Typed
0.112	0.376	44

Synonyms: rs6269 ;
Frequency Display Formats:

Estimated Heterozygosity:

Frequency Download:

External Resources: dbSNP rs # Record PharmGKB Variant Information Record
References: See References
Polymorphism Description: C___2538746_1_ is an ABI Assays-on-Demand ^TM SNP Genotyping Assay ID. This is a A/G SNP in the untranslated region of COMT gene.
Ancestral Allele: G
Alleles:

Allele Name	Allele Symbol	Description
A	A	5' - tctgaaccttgcccctctgc A aacacaagggggcgatggtg - 3'
G	G	5' - tctgaaccttgcccctctgc G aacacaagggggcgatggtg - 3'

References:
- Kenneth K. Kidd et al. "Data unpublished".

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan