ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
E_rs2646012SI001664Rrs2646012 is intergenic between ADH1C and ADH7rs2646012
Previously associated with :  ADH7
FstAvg Het# Populations Typed
0.1260.24662
Synonyms: rs2646012 ;
Frequency on Map:    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: dbSNP rs # Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  This is a G/C SNP in the intergenic region of ADH7-ADH1C genes.
Ancestral Allele:  G
Alleles:
Allele NameAllele SymbolDescription
CC5' - agcaagggcttaagccact C ttagttagtattctgtaact - 3'
GG5' - agcaagggcttaagccact G ttagttagtattctgtaact - 3'

References:
- Han Y, Oota H, Sheng Gu, Osier M, Pakstis AJ, Speed WC, Kidd JR, Kidd KK "Evidence of Positive Selection on a Class I ADH Locus". American Journal of Human Genetics 80:441-56. (2007) Online citation.

- Kenneth K. Kidd et al. "Data unpublished".

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan