ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
C___2688455_1_SI001676UAlcohol Dehydrogenase 1B (class I), beta polypeptide ADH1B
FstAvg Het# Populations Typed
0.3120.326109
Synonyms: rs1042026 ;
Frequency on Map:    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: dbSNP rs # Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  C___2688455_1_ is an ABI Assays-on-DemandTM SNP Genotyping Assay ID. This is a A/G SNP in the intergenic region of ADH1B-1A genes.

Note: this taqman assay types the other strand and the corresponding alleles are T and C respectively.
Alleles:
Allele NameAllele SymbolDescription
AA5' - ttacaagtagtgaaggtcc A agagttctaaatacaggaaa - 3'
GG5' - ttacaagtagtgaaggtcc G agagttctaaatacaggaaa - 3'

References:
- Kenneth K. Kidd et al. "Data unpublished".

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan