ALFRED
      The ALlele FREquency Database   
A resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
intron 13 C/T (-13910 ) SNPSI001784UMCM6 minichromosome maintenance deficient 6MCM6
FstAvg Het# Populations Typed
0.1890.20817
Synonyms: rs4988235 ;
Frequency on Map:   Open in Google Earth    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:     
External Resources: dbSNP rs # Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  This is a C/T SNP in the intron region of MCM6 gene. The -13910*T allele introduces a BsmFI restriction site.

The primer sets ,pcr amplification conditions and restriction product sizes are detailed in Coelho et.al.
Alleles:
Allele NameAllele SymbolDescription
CC5' - atacagataagataatgtag C ccctggcctcaaaggaactc - 3'
TT5' - atacagataagataatgtag T ccctggcctcaaaggaactc - 3'

References:
- Coelho M, Luiselli D, Bertorelle G, Lopes AI, Seixas S, Destro-Bisol G, Rocha J. "Microsatellite variation and evolution of human lactase persistence". Hum Genet. 117:329-339. (2005)
Online citation.


© 2010 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan