ALFRED: allele frequency database

The ALlele FREquency Database
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.

ALFRED detailed record information

Polymorphism Information

Name	ALFRED UID	Locus Name	Locus Symbol
C__11887110_1_	SI001918T	rs987640 is intergenic between LOC100652760 and LARGE	rs987640

Fst	Avg Het	# Populations Typed
0.053	0.473	46

Synonyms: rs987640 ;
Frequency Display Formats:

Estimated Heterozygosity:

Frequency Download:

External Resources: dbSNP rs # Record PharmGKB Variant Information Record
References: See References
Polymorphism Description: C__11887110_1_ is an ABI Assays-on-Demand^TM SNP Genotyping Assay ID. This is a A/T SNP in the intron region of LOC650568 gene.

This marker has been selected for low Fst value ( Fst ≤0.06 ) for potential forensic use.
Ancestral Allele: A
Alleles:
Allele Name Allele Symbol Description
A A 5' - aacaggctctctttccaccc A tgtagaaatacaaaaataag - 3'
T T 5' - aacaggctctctttccaccc T tgtagaaatacaaaaataag - 3'

References:
- Kenneth K. Kidd et al. "Data unpublished".

- Kidd KK, Pakstis AJ, Speed WC, Grigorenko EL, Kajuna SL, Karoma NJ, Kungulilo S, Kim JJ, Lu RB, Odunsi A, Okonofua F, Parnas J, Schulz LO, Zhukova OV, Kidd JR "Developing a SNP panel for forensic identification of individuals". Forensic Sci Int. 164:20-32. (2006) Online citation.

- Pakstis AJ, Speed WC, Kidd JR, Kidd KK. "Candidate SNPs for a Universal Individual Identification Panel". Human Genetics 121:305-317. (2007) Online citation.

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan