ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
Leu374PheSI003963VSolute carrier family 45, member 2SLC45A2
FstAvg Het# Populations Typed
0.640.156125
Synonyms: L374F ; rs16891982 ;
Frequency on Map:    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: dbSNP rs # Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  This is a C/G SNP in exon 5 of the SLC45A2 gene. This SNP results in the non-synonymous substitution of Leucine (TTG) -> Phenylalanine (TTC) at aminoacid position 374 of the gene. The derived allele C=Phe on the coding/reverse strand, is associated with light skin color and is common only in populations of European ancestry. This SNP is commonly included in panels of ancestry informative SNPs and in phenotype informative markers.
Ancestral Allele:  C (on the + strand)
Alleles:
Allele NameAllele SymbolDescription
CC5' - gaggttggatgttggggc TTC tgcatcaactccgtgttttc - 3'
GG5' - gaggttggatgttggggc TTG tgcatcaactccgtgttttc - 3'

References:
- Yuasa I, Umetsu K, Watanabe G, Nakamura H, Endoh M, Irizawa Y. "MATP polymorphisms in Germans and Japanese: the L374F mutation as a population marker for Caucasoids". Int J Legal Med. 118:364-366. (2004) Online citation.

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan