ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
rs1015250SI004006Krs1015250 is intergenic between RPS27AP14 and SMARCA2rs1015250
FstAvg Het# Populations Typed
0.2240.37869
Synonyms: rs1015250 ;
Frequency on Map:    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: dbSNP rs # Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  This is a C/G SNP.

Note:Sanchez et al.(2006) originally typed this marker on 9 population samples as part of 'SNPforID' panel. Others subsequently typed on additional populations.
Ancestral Allele:  C
Alleles:
Allele NameAllele SymbolDescription
CC5' - aacccaggtgttttatt C ctgtcccagtgatttttcat - 3'
GG5' - aacccaggtgttttatt G ctgtcccagtgatttttcat - 3'

References:
- Sánchez JJ, Phillips C, Borsting C, Balogh K, Bogus M, Fondevila M, Harrison CD, Musgrave-Brown E, Salas A, Syndercombe-Court D, Schneider PM, Carracedo A, Morling N. "A multiplex assay with 52 single nucleotide polymorphisms for human identification". Electrophoresis. 27:1713-1724. (2006) Online citation.

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan