ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
(5592)C/TSI004322LAngiotensinogen (serpin peptidase inhibitor, clade A, member 8)AGT
FstAvg Het# Populations Typed
Synonyms: rs2493133 ;
Frequency on Map:    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: dbSNP rs# Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  It is a T/C SNP in the intron region of AGT gene.
Allele NameAllele SymbolDescription
CC5' - atccccccatctatcacctc C ccctgaacccgaagggaaag - 3'
TT5' - atccccccatctatcacctc T ccctgaacccgaagggaaag - 3'

- Nakajima T, Wooding S, Sakagami T, Emi M, Tokunaga K, Tamiya G, Ishigami T, Umemura S, Munkhbat B, Jin F, Guan-Jun J, Hayasaka I, Ishida T, Saitou N, Pavelka K, Lalouel JM, Jorde LB, Inoue I. "Natural selection and population history in the human angiotensinogen gene (AGT): 736 complete AGT sequences in chromosomes from around the world". Am J Hum Genet 74:898-916. (2004)
Online citation.

© 2016 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan