ALFRED: allele frequency database

The ALlele FREquency Database
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.

ALFRED detailed record information

Polymorphism Information

Name	ALFRED UID	Locus Name	Locus Symbol
rs9617857	SI013919X	Armadillo repeat gene deletes in velocardiofacial syndrome	ARVCF

Fst	Avg Het	# Populations Typed
0.139	0.273	78

Synonyms: rs9617857 ; rs12168204 ;
Frequency Display Formats:

Estimated Heterozygosity:

Frequency Download:

External Resources: dbSNP rs# Record PharmGKB Variant Information Record
References: See References
Polymorphism Description: This is a G/T SNP in the intron region of ARVCF gene.
Alleles:

Allele Name	Allele Symbol	Description
G	G	5' - caaagatggtttcactggt G tattctaccaaacattcaag - 3'
T	T	5' - caaagatggtttcactggt T tattctaccaaacattcaag - 3'

References:
- Mukherjee N, Kidd KK, Pakstis AJ, Speed WC, Li H, Tarnok Z, Barta C, Kajuna SLB, Kidd JR "The Complex Global Pattern of genetic variation and linkage disequilibrium at Catechol-O-methyl transferase (COMT)". Molecular Psychiatry 15:216-225. (2010) Online citation.

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan