ALFRED: allele frequency database

The ALlele FREquency Database
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.

ALFRED detailed record information

Polymorphism Information

Name	ALFRED UID	Locus Name	Locus Symbol
rs16947	SI015497A	Cytochrome P450, family 2, subfamily D, polypeptide 6	CYP2D6

Fst	Avg Het	# Populations Typed
0.145	0.41	39

Synonyms: rs16947 ;
Frequency Display Formats:

Estimated Heterozygosity:

Frequency Download:

External Resources: dbSNP rs# Record PharmGKB Variant Information Record
References: See References
Polymorphism Description: This is a A/G SNP in the coding region of CYP2D6 gene. This SNP results in non-synonymous substitution Cysteine(TGC) -> Arginine(CGC) at aminoacid position 296 of the gene.
Ancestral Allele: G
Alleles:

Allele Name	Allele Symbol	Description
Arg	G	5'- caggtcagccaccactatgc G caggttctcatcattgaagc -3'
Cys	A	5'- caggtcagccaccactatgc A caggttctcatcattgaagc -3'

References:
- Sistonen J, Sajantila A, Lao O, Corander J, Barbujani G, Fuselli S "CYP2D6 worldwide genetic variation shows high frequency of altered activity variants and no continental structure". Pharmacogenet Genomics. 17:93-101. (2007) Online citation.

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan