ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
rs1078830SI019026Shypothetical LOC100128977LOC100128977
FstAvg Het# Populations Typed
0.1320.10644
Synonyms: rs1078830 ;
Frequency on Map:    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: dbSNP rs# Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  This is a C/T SNP in the intron region of LOC100128977 gene.
Alleles:
Allele NameAllele SymbolDescription
CC5'- ctttgaggagagcccagagc Cgaagcaattagtcaaaggt -3'
TT5'- ctttgaggagagcccagagc Tgaagcaattagtcaaaggt -3'

References:
- Donnelly MP, Paschou P, Grigorenko3 E, Gurwitz D, Mehdi SQ, Kajuna SLB, Barta C, Kungulilo S, Karoma NJ, Lu R-B, Zhukova OB, Kim JJ,Comas D, Siniscalco M, New M, Li P, Li H, Manolopoulos VG, Speed WC, Rajeevan H, Pakstis AJ, Kidd JR, Kidd KK. "The Distribution and Most Recent Common Ancestor of the 17q21 Inversion in Humans. ". Am. J of Human Genetics 86:161-71. (2010)
Online citation.


© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan