ALFRED
      The ALlele FREquency Database   
A resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
rs11809593SI114512OATP-binding cassette, sub-family A (ABC1), member 4ABCA4
FstAvg Het# Populations Typed
001
Synonyms: rs11809593 ;
Frequency on Map:   Open in Google Earth    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:     
External Resources: dbSNP rs# Record  
References: See References
Polymorphism Description:  This is a C/T SNP
Alleles:
Allele NameAllele SymbolDescription
CC5' - taaggatatctttctcatcc C gttgaggcctccacacccca - 3'
TT5' - taaggatatctttctcatcc T gttgaggcctccacacccca - 3'

References:
- Kenneth K. Kidd et al. "Data unpublished".

© 2009 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan