ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
rs589448SI464144XYEATS domain containing 4YEATS4
FstAvg Het# Populations Typed
0.0560.44751
Synonyms: rs589448 ;
Frequency on Map:    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: dbSNP rs# Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  This is a A/G SNP
Alleles:
Allele NameAllele SymbolDescription
AA5' - ctcctccatccccatcaagc A tagtacccttctccaaagcc - 3'
GG5' - ctcctccatccccatcaagc G tagtacccttctccaaagcc - 3'

References:
- Kenneth K. Kidd et al. "Data unpublished".


© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan