ALFRED: allele frequency database

The ALlele FREquency Database
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.

ALFRED detailed record information

Polymorphism Information

Name	ALFRED UID	Locus Name	Locus Symbol
rs1467966	SI663668J	Microtubule-associated protein tau	MAPT

Fst	Avg Het	# Populations Typed
0.037	0.208	3

Synonyms: rs1467966 ;
Frequency Display Formats:

Estimated Heterozygosity:

Frequency Download:

External Resources: dbSNP rs# Record PharmGKB Variant Information Record
References: See References
Polymorphism Description: This is a C/T SNP.
Alleles:

Allele Name	Allele Symbol	Description
C	C	5'- tgcatgccattgccaaattc C tcccagagcaaccccgtca -3'
T	T	5'- tgcatgccattgccaaattc T tcccagagcaaccccgtca -3'

References:
- Dixon LA, Murray CM, Archer EJ, Dobbins AE, Koumi P, Gill P. "Validation of a 21-locus autosomal SNP multiplex for forensic identification purposes". Forensic Sci Int. 154:62-77. (2005) Online citation.

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan