ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
rs11568350(Gln248His)SI663767Jsolute carrier family 40 (iron-regulated transporter), member 1SLC40A1
FstAvg Het# Populations Typed
Synonyms: rs11568350 ;
Frequency on Map:    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: dbSNP rs# Record  
References: See References
Polymorphism Description:  This is a G/T SNP in the coding region of SLC40A1 gene. This SNP results in non-synonymous substitution Glutamine(CAG) -> Histidine(CAT) at aminoacid position 248 of the gene.
Allele NameAllele SymbolDescription
Gln(G)Q (G)5'- gaggaaactgaattgaaa CAG ctgaatttacacaaaggtaa -3'
His (T)H (T)5'- gaggaaactgaattgaaa CAT ctgaatttacacaaaggtaa -3'

- Albuquerque D, Manco L, Loua KM, Arez AP, Trovoada Mde J, Relvas L, Millimono TS, Rath SL, Lopes D, Nogueira F, Varandas L, Alvarez M, Ribeiro ML. "SLC40A1 Q248H allele frequencies and associated SLC40A1 haplotypes in three West African population samples". Ann Hum Biol. 38:378-81. (2011)
Online citation.

© 2016 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan