ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
rs686SI663846HInsulinINS
FstAvg Het# Populations Typed
00.391
Synonyms:
Frequency on Map:    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: dbSNP rs# Record  
References: See References
Polymorphism Description:  This is a A/T SNP in the 5'UTR of the Insulin gene.
Alleles:
Allele NameAllele SymbolDescription
AA5'- ctgcctcagccctgcctgtc A cccagatcactgtccttctg -3'
TT5'- ctgcctcagccctgcctgtc T cccagatcactgtccttctg -3'

References:
- Cimponeriu D, Apostol P, Radu I, Craciun AM, Serafinceanu C, Toma M, Panaite C, Cheta D. "The insulin polymorphism -23Hph increases the risk for type 1 diabetes mellitus in the Romanian population". Genet Mol Biol 33:610-4. (2010) Online citation.

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan