ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
rs2071075SI663866Jatrophin 1ATN1
FstAvg Het# Populations Typed
0.2520.16347
Synonyms: rs2071075 ;
Frequency on Map:    
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: dbSNP rs# Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  this is a C/T SNP in the intron region of ATN1 gene.
Alleles:
Allele NameAllele SymbolDescription
CC5'-agacagccaaggtattctgt C ctcaggtcctcccacaggat -3'
TT5'-agacagccaaggtattctgt Tctcaggtcctcccacaggat -3'

References:
- Brissenden J, Kidd JK, Evsannaa B, Togtakh A, Kidd KK, Roscoe J "Mongolians in the Genetic Landscape of Central Asia". HGM2012, Poster Presentation, Sydney, Australia (2012)

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan