ALFRED: allele frequency database

The ALlele FREquency Database
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.

ALFRED detailed record information

Name	ALFRED UID	Locus Name	Locus Symbol
rs2227945	SI663871F	Breast cancer 1, early onset	BRCA1

Fst	Avg Het	# Populations Typed
0.057	0.015	47

Synonyms: rs2227945 ;
Frequency Display Formats:

Estimated Heterozygosity:

Frequency Download:

External Resources: dbSNP rs# Record PharmGKB Variant Information Record
References: See References
Polymorphism Description: This is a A/G SNP in the coding region of BRCA1 gene.
Alleles:

Allele Name	Allele Symbol	Description
A	A	5'- tagaacagcctatgggaagt A gtcatgcatctcaggtttgt -3'
G	G	5'- tagaacagcctatgggaagt G gtcatgcatctcaggtttgt -3'

References:
- Brissenden J, Kidd JK, Evsannaa B, Togtakh A, Kidd KK, Roscoe J "Mongolians in the Genetic Landscape of Central Asia". HGM2012, Poster Presentation, Sydney, Australia (2012)

© 2012 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan