ALFRED

The ALlele FREquency Database
A resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.

ALFRED detailed record information

Polymorphism Information

Name	ALFRED UID	Locus Name	Locus Symbol
Leu374Phe	SI003963V	Solute carrier family 45, member 2	SLC45A2

Fst	Avg Het	# Populations Typed
0.667	0.124	85

Synonyms: L374F ; rs16891982 ;
Frequency Display Formats:

Estimated Heterozygosity:

Frequency Download:

External Resources: dbSNP rs # Record PharmGKB Variant Information Record
References: See References
Polymorphism Description: This is a C/G SNP in exon 5 of the SLC45A2 gene. This SNP results in non-synonymous substitution Leucine (TTG) -> Phenylalanine (TTC) at aminoacid position 374 of the gene.
Ancestral Allele: C
Alleles:

Allele Name	Allele Symbol	Description
Leu	G	5' - gaggttggatgttggggc TTG tgcatcaactccgtgttttc - 3'
Phe	C	5' - gaggttggatgttggggc TTC tgcatcaactccgtgttttc - 3'

References:
- Yuasa I, Umetsu K, Watanabe G, Nakamura H, Endoh M, Irizawa Y. "MATP polymorphisms in Germans and Japanese: the L374F mutation as a population marker for Caucasoids". Int J Legal Med. 118:364-366. (2004) Online citation.

© 2010 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan