ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
00ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
C___9506826_10SI000883TTaste receptor, type 2, member 38 TAS2R38
FstAvg Het# Populations Typed
Synonyms: Ile296Val ; rs10246939 ;
Frequency Display Formats:     
Estimated Heterozygosity: 
External Resources: dbSNP rs # Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  This is a T/C SNP
Ancestral Allele:  V
Allele NameAllele SymbolDescription
CC5' - gatcaggac C tgcatgcccagagggacaag - 3'
TT5' - agatcaggat T tgcatgcccagagggacaag - 3'

- Davidson AC, Pakstis AJ, Speed WC, Bartoshuk L, Duffy V, Friedlaender J, Grigorenko EL, Kajuna SLJ, Karoma NJ, Kim JJ, Kungulilo S, Lu RB, Odunsi A, Okonofua F, Parnas J, Schulz LO, Snyder DJ, Zhukova OV, Kidd KK, Kidd JR. "No Evidence for balancing Selection at the TAS2R38 (PTC) Gene". Submitted

- Kim UK, Jorgenson E, Coon H, Leppert M, Risch N, Drayna D. "Positional cloning of the human quantitative trait locus underlying taste sensitivity to phenylthiocarbamide". Science. 299:1221-5. (2003) Online citation.

© 2019 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan